Design PCR Primers

Use DECIPHER's DesignPrimers function to design the optimal set of PCR primers for targeting one group of DNA sequences in the presence of many non-target groups, as described in:
For an in-depth tutorial, see the "Design Group-Specific Primers" vignette on the Documentation page.

How do I design PCR primers?

First it is necessary to install DECIPHER and load the library in R. Next, set the "fas" variable to the path to the FASTA file of aligned sequences (e.g., "~/mySeqs.fas").

Show output

12-345678910




-111213141516171819










-20



21




















-22232425







26




































-27library(DECIPHER)library(RSQLite)
# load sequences into a databasefas <- "~/mySeqs.fas"dbConn <- dbConnect(SQLite(),":memory:")Seqs2DB(fas,type="FASTA",dbFile=dbConn,identifier="")Reading FASTA file chunk 1
118 total sequences in table Seqs.Time difference of 0.04 secs

# identify the sequences based on their descriptionx <- dbGetQuery(dbConn,"select description from Seqs")$descriptionns <- unlist(lapply(strsplit(x,split=" "),FUN=`[`,1L))Add2DB(myData=data.frame(identifier=ns),dbFile=dbConn)Expression:update `Seqs` set `identifier` = (select`temp`.`identifier` from `temp` where`temp`.`row_names` = `Seqs`.`row_names`) whereexists (select `temp`.`identifier` from `temp`where `temp`.`row_names` = `Seqs`.`row_names`)
Added to table Seqs:  "identifier".
Time difference of 0.01 secs

tiles <- TileSeqs(dbConn)  |========================================| 100%
Time difference of 13.63 secs
head(tiles)  row_names start end start_aligned end_aligned1         1     1  27             1          272         2     2  28             2          283         3     3  29             3          294         4     4  30             4          305         5     5  31             5          316         6     6  32             6          32  misprime width            id coverage1    FALSE  1594 Acinetobacter        12    FALSE  1594 Acinetobacter        13    FALSE  1594 Acinetobacter        14    FALSE  1594 Acinetobacter        15    FALSE  1594 Acinetobacter        16    FALSE  1594 Acinetobacter        1  groupCoverage                 target_site1             1 AGAGTTTGATCATGGCTCAGATTGAAC2             1 GAGTTTGATCATGGCTCAGATTGAACG3             1 AGTTTGATCATGGCTCAGATTGAACGC4             1 GTTTGATCATGGCTCAGATTGAACGCT5             1 TTTGATCATGGCTCAGATTGAACGCTG6             1 TTGATCATGGCTCAGATTGAACGCTGG
primers <- DesignPrimers(tiles,identifier="Streptococcus", # target groupminProductSize=50, # base pairsnumPrimerSets=1) # candidates to designStreptococcus (1325 candidate primers):  |========================================| 100%
Determining Best Primer Pair:  |========================================| 100%
Time difference of 14 secs
head(primers)     identifier start_forward start_reverse1 Streptococcus           533          1289  product_size start_aligned_forward1          757                   553  start_aligned_reverse permutations_forward1                  1336                    1  permutations_reverse score_forward1                    1  -2.87986....  score_reverse score_set     forward_primer.11  -0.00023....         0 CCGCGGTAATACGTAGGTCC  forward_primer.2 forward_primer.31                            forward_primer.4     reverse_primer.11              GATTAGCTTGCCGTCACCGG  reverse_primer.2 reverse_primer.31                            reverse_primer.4 forward_efficiency.11                         0.8161955  forward_efficiency.2 forward_efficiency.31                   NA                   NA  forward_efficiency.4 reverse_efficiency.11                   NA            0.8857364  reverse_efficiency.2 reverse_efficiency.31                   NA                   NA  reverse_efficiency.4 forward_coverage.11                   NA                  1  forward_coverage.2 forward_coverage.31                 NA                 NA  forward_coverage.4 reverse_coverage.11                 NA                  1  reverse_coverage.2 reverse_coverage.31                 NA                 NA  reverse_coverage.4 mismatches_forward1                 NA                                                                     mismatches_reverse1 Porphyromonas (0.0232%,GATTAGCTTGCCGTCACCGG/CCGGTGACTGGGGCTAAGTC)   mismatches_set
dbDisconnect(dbConn)